single-stranded dna  (Integrated DNA Technologies)

Journal: eLife

Article Title: Structure of the human CTF18−RFC clamp loader bound to PCNA

doi: 10.7554/eLife.103493

Figure Lengend Snippet: ( a ) Time course reactions on M13mp18 single-strand DNA with 40 nM wild-type CTF18–RFC or CTF18 Δ165–194 –RFC. Reactions were performed as described in Materials and methods. ( b ) Quantification of the band intensities from the primer extension assay shows that the rate of increase in intensity, derived from the initial linear portion of the reaction time before saturation, is 4142 ± 95 a.u./min for CTF18–RFC and 2389 ± 143 a.u./min for CTF18 Δ165–194 –RFC. This indicates that the mutant slows Pol ε synthesis by 42%. The experiment was conducted three times. Dots in ( b ) represent mean values from the three replicas. Figure 7—source data 1. TIFF file containing uncropped agarose gel image indicating the relevant bands. Figure 7—source data 2. TIFF file containing uncropped and unlabelled agarose gel image.

Article Snippet: For the prime extension assay, Oligo (592: TAACGCCAGGGTTTTCCCAGTCACG ) (Integrated DNA Technologies) was annealed to 50 nM M13mp18 single-stranded DNA (New England Biolabs) in a reaction buffer consisting of [10 mM Tris-HCl (pH 7.6), 100 mM NaCl, and 5 mM EDTA].

Techniques: Primer Extension Assay, Derivative Assay, Mutagenesis, Agarose Gel Electrophoresis

Journal: eLife

Article Title: Structure of the human CTF18−RFC clamp loader bound to PCNA

doi: 10.7554/eLife.103493

Figure Lengend Snippet: CTF18–RFC or CTF18 Δ165–194 –RFC concentration titration reactions on M13mp18 single-strand DNA. Reactions were running for 10 min at 37°C. Figure 7—figure supplement 1—source data 1. TIFF file containing uncropped agarose gel image indicating the relevant bands. Figure 7—figure supplement 1—source data 2. TIFF file containing uncropped and unlabelled agarose gel image.

Article Snippet: For the prime extension assay, Oligo (592: TAACGCCAGGGTTTTCCCAGTCACG ) (Integrated DNA Technologies) was annealed to 50 nM M13mp18 single-stranded DNA (New England Biolabs) in a reaction buffer consisting of [10 mM Tris-HCl (pH 7.6), 100 mM NaCl, and 5 mM EDTA].

Techniques: Concentration Assay, Titration, Agarose Gel Electrophoresis